The Heat Shock Protein Inhibitor Quercetin Attenuates

The Heat Shock Protein Inhibitor Quercetin Attenuates

Hepatitis C Virus Production

Oscar Gonzalez,1 Vanessa Fontanes,2 Santanu Raychaudhuri,3 Rachel Loo,4 Joseph Loo,4,5,6 Vaithilingaraja Arumugaswami,7 Ren Sun,6,7,8,9 Asim Dasgupta,2,6,8,9 and Samuel W. French1,8

The hepatitis C viral (HCV) genome is translated through an internal ribosome entry site (IRES) as a single polyprotein precursor that is subsequently cleaved into individual mature viral proteins. Non-structural protein 5A (NS5A) is one of these proteins that has been implicated in regulation of viral genome replication, translation from the viral IRES and viral packaging. We sought to identify cellular proteins that interact with NS5A and determine whether these interactions may play a role in viral production. Mass spectrometric analysis of coimmunoprecipitated NS5A complexes from cell extractsidenti?edheatshockproteins(HSPs)40and70.Wecon?rmedanNS5A/HSPinteractionby confocal microscopy demonstrating colocalization of NS5A with HSP40 and with HSP70. Western analysis of coimmunoprecipitated NS5A complexes further con?rmed interaction of HSP40 and HSP70 with NS5A. A transient transfection, luciferase-based, tissue culture IRES assay demonstrated NS5A augmentation of HCV IRES-mediated translation, and small interfering RNA (siRNA)-mediated knockdown of HSP70 reduced this augmentation. Treatment with an inhibitor of HSP synthesis, Quercetin, markedly reduced baseline IRES activity and its augmentation by NS5A. HSP70 knockdown also modestly reduced viral protein accumulation, whereas HSP40 and HSP70 knockdown both reduced infectious viral particle production in an HCV cell culture system using the J6/JFH virus fused to the Renilla luciferase reporter. Treatment with Quercetin reduced infectious particle production at nontoxic concentrations. The marked inhibition of virus production by Quercetin may partially be related to reduction of HSP40 and HSP70 and their potential involvement in IRES translation, as well as viral morphogenesis or secretion. Conclusion: Quercetin may allow for dissection of the viral life cycle and has potential therapeutic use to reduce virus production with low associated toxicity. (HEPATOLOGY 2009;50:1756-1764.)

Abbreviations: BB, blocking buffer; DMSO, dimethylsulfoxide; GFP, green ?uorescing protein; HCV, hepatitis C virus; HSP, heat shock protein; IRES, internal ribosome entry site; MSCV, murine stem cell virus; NS5A, nonstructural protein 5A; PCR, polymerase chain reaction; siRNA, small interfering RNA.

From the 1Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at University of California, Los Angeles, CA; the 2Department of Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, CA; the 3Department of Pediatrics, David Geffen School of Medicine at University of California, Los Angeles, CA; the 4Department of Biological Chemistry, David Geffen School of Medicine at University of California, Los Angeles, CA; the 5Department of Chemistry and Biochemistry, University of California, Los Angeles, CA; the 6UCLA Molecular Biology Institute, Los Angeles, CA; the 7Department of Molecular and Medical Pharmacology, University of California, Los Angeles, CA; 8Jonsson Comprehensive Cancer Center, Los Angeles, CA; and the 9UCLA AIDS Institute, Los Angeles, CA.

Received April 2, 2009; accepted August 1, 2009.

Supported by the Cure Digestive Diseases Research Center (S.W.F.), Stein Oppenheimer Endowment Award (S.W.F.), National Institutes of Health (NIH) grant 1K22CA120147-01A1 (S.W.F.), and NIH grant AI 072180 (A.D.).

Address reprint requests to: Samuel W. French, M.D., Ph.D., Assistant Professor, Liver and Gastrointestinal Pathology, Department of Pathology and Laboratory Medicine, UCLA Center for Health Sciences, 10833 Le Conte Avenue, Los Angeles, CA 90095-1732. E-mail: sfrench@mednet.ucla.edu; fax: 310-267-2058.

Copyright © 2009 by the American Association for the Study of Liver Diseases.

Published online in Wiley InterScience (www.interscience.wiley.com).

DOI 10.1002/hep.23232

Potential con?ict of interest: Nothing to report.

epatitis C virus (HCV) infection has a worldwide prevalence of 3% and is the main entity responsible for liver transplantation for treatment of cirrhosis in developed countries.1 In the United States, HCV is the most common chronic blood-borne infection, affecting 1.8% of the population, and it appears to be the major causative factor responsible for the recent doubling of hepatocellular carcinoma in the United States.2 Current therapy consists of pegylated interferon-alpha and ribavirin, which results in 76% to 82% sustained virological response in patients infected with genotypes 2 and 3.3 Unfortunately, 70% of patients in the United States are infected with genotype 1, for which sustained virological response is signi?cantly lower at 42% to 46%. Generally, therapy of all genotypes can be accompanied by adverse effects, and contraindications to therapy are not infrequent.4 For these reasons, there is a need to develop additional therapies that are less toxic and result in higher sustained virological response either as adjuncts or replacement therapies.

Heat shock proteins (HSPs), including HSP40 and HSP70, are required for cell survival during stress and have classically been designated as protein chaperones required for proper protein folding, protein degradation, and reactivation of damaged proteins.5,6 More recently HSPs have been found to be highly expressed in malignancies, including hepatocellular carcinoma, which has elevated levels of HSP70 compared with benign liver and benign liver proliferations.7 Infection by viruses, including human immunode?ciency virus 1, polyomaviridae, molluscum contagiosum, in?uenza, hepatitis B, human T-lymphotropic virus, papilloma-virus, and adenovirus, has been shown to induce HSPs and facilitate viral production.8 Two viruses actually encode their own HSP homologs. Closteroviridae encode an HSP70 homolog, and polyomaviridae encode a DNAJ homolog containing protein (T antigen) that activates HSP70 in a similar fashion to HSP40 (a DNAJ motif containing protein).

The HCV nonstructural protein 5A (NS5A) protein is a 56-kDa to 59-kDa phosphoprotein that has been found to be associated with the viral replicase complex. It has been implicated in the regulation of HCV genome replication, internal ribosome entry site (IRES)-mediated translation of the viral polypeptide, and viral assembly.9-12 NS5A also appears to regulate cell signaling through interaction with several key proteins, including GRB2, PI3K, SRC proteins, P53, BAX, and CDK1.11 Additionally, NS5A interacts with double-stranded RNA-dependent protein kinase blocking the antiviral response and apoptosis.13

Here, we report identi?cation of HSP70 and HSP40 in complex with NS5A and implicate HSPs in HCV IRES–mediated translation. Furthermore, treatment with the HSP expression inhibitor Quercetin14,15 reduced IRES translation. Treatment of HCV infection with Quercetin in tissue culture lowered intracellular viral accumulation and infectious particle production.

Materials and Methods

Cell Culture. The cell lines 293T, Huh-7, and Huh

7.5 were maintained in a humidi?ed atmosphere containing 5% CO2 at 37°C in Dulbecco’s modi?ed Eagle’s medium (Fisher Scienti?c, Pittsburgh, PA) supplemented with 10% fetal bovine serum (Omega Scienti?c, Tarzana, CA), 100 U/mL penicillin-streptomycin, and 2 mM L-glutamine (Invitrogen, Carlsbad, CA). In all experiments, Quercetin was used at 50 fM.

Antibodies. Antibodies used in this study were: f-Actin (Cell Signaling Technology, Danvers, MA), HSP70 (Santa Cruz Biotech, Santa Cruz, CA), HSP40 (Abcam, Cambridge, MA), NS5A (Abcam), and FLAG (Stratagene, La Jolla, CA)

Plasmid Constructs and Virus. An MSCV-GFPIRES-PURO (pMSCVGFP) retroviral expression vector was a gift of D. Rawlings. An NS5AFLAG-expressing plasmid (pMSCVNS5AFLAG) was generated by performing polymerase chain reaction (PCR) on the H77 strain (serotype 1a) clone of HCV with end-modi?ed primers synthesized by Integrated DNA Technologies, Inc. (Coralville, IA): NS5A fwd 5'AAAAAAACCGGTGCCGCCATGTCCGGTTCCTGGCTAAGGGAC3' and NS5A rev 5'AAAAAGATCTGCAGCACQCGQCQTCTTCCG3 '. The product was digested by AgeI and BglII followed by cloning into an MSCV-FLAG-IRESPURO retroviral vector precut with AgeI and BamHI. Construct integrity was veri?ed by sequencing. The IRES reporter construct has been previously described.16